Journal: International Journal of Neuropsychopharmacology

Article Title: Plasticity of Functional MAOA Gene Methylation in Acrophobia

doi: 10.1093/ijnp/pyy050

Figure Lengend Snippet: Functional analysis of MAOA promoter/exon I/intron I DNA methylation using luciferase-based reporter gene assays. Left: Normalized reporter gene activity was significantly decreased in the presence of pCpGfree-promoter Lucia_MAOA vectors containing the methylated insert spanning CpGs 1–13 compared with those carrying a nonmethylated insert; *** P < .001. Right: No significant difference in normalized reporter gene activity was discerned between methylated or non-methylated pCpGfree-promoter Lucia control vectors lacking the insert of the sequence spanning CpGs 1–13.

Article Snippet: Functional analysis was accomplished using the pCpGfree-promoter- Lucia vector (InvivoGen) expressing a Lucia luciferase under a human elongation factor-1 (hEF1) promoter.

Techniques: Functional Assay, DNA Methylation Assay, Luciferase, Activity Assay, Methylation, Sequencing

Journal: The Journal of Biological Chemistry

Article Title: Epigenetic Modulation of Intestinal Cholesterol Transporter Niemann-Pick C1-like 1 (NPC1L1) Gene Expression by DNA Methylation *

doi: 10.1074/jbc.M113.546283

Figure Lengend Snippet: Effect of DNA methylation on NPC1L1 promoter activity. Human NPC1L1 promoter region flanking the area between −1741 and +56 (+1 is the transcription initiation site) was amplified by PCR and cloned into a promoterless CpG free vector (pCpG free basic lucia) upstream of the lucia gene. The NPC1L1 promoter construct as well as the empty vector were then subjected to in vitro methylation. The methylated and unmethylated empty vector (pEV) and NPC1L1 promoter construct (L1p) were transiently transfected into Caco2 cells along with the mammalian expression vector of β-galactosidase. 48 h post-transfection, cells were harvested, and lucia activity and β-galactosidase activity were measured. The relative promoter activity was determined as a ratio of lucia to β-galactosidase (A). Data are presented as fold increase compared with unmethylated empty vector and represent mean ± S.E. of three independent experiments performed on separate occasions. *, p < 0.05 compared with empty vector pEV. CpG free EF1 promoter lucia vector (pCpG free lucia) was used as control for methylation as described under “Results” (B). Data are presented as fold change relative to unmethylated vector.

Article Snippet: For the construction of pCpG free L1 vector, the DNA fragment containing −1741/+56 region of the human NPC1L1 promoter was amplified using forward 5-ATCGATGCGAGTACTTGGACTCTATCTCTCTGTGG-3′ and reverse 5-ATCGATGCGAAGCTTCCCAGGTCTGGGAAGGGGTCA-3′ primers, and the amplified promoter fragments were then inserted into a promoterless CpG free vector (pCpG free basic lucia, InvivoGen, San Diego) upstream of the lucia reporter gene.

Techniques: DNA Methylation Assay, Activity Assay, Amplification, Clone Assay, Plasmid Preparation, Construct, In Vitro, Methylation, Transfection, Expressing, Control

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

doi: 10.1152/ajpgi.00293.2017

Figure Lengend Snippet: Effect of DNA methylation on Na+/H+ exchanger-3 (NHE3) promoter activity in Caco-2 cells. A: human (h) NHE3 promoter region flanking the area between −1509 and +127 (+1 is the transcription initiation site) was amplified by PCR and cloned in a promoterless cytosine guanine dinucleotide (CpG)-free vector upstream of the lucia gene (pCpG-EV). B: CpG-free EF1 promoter lucia vector (pCpG- hEF1) was used as control for methylation. The NHE3 promoter construct (pCpG-NHE3) and the control vector (pCpG- hEF1) were subjected to in vitro DNA methylation. The methylated and unmethylated control vector and NHE3 promoter construct were transiently transfected in Caco-2 cells along with the mammalian expression vector of β-galactosidase. Posttransfection (48 h), cells were harvested, and lucia activity and β-galactosidase activity were measured. The relative promoter activity was determined as a ratio of lucia to β-galactosidase. Results represent means ± SE of 3–4 separate experiments and are expressed as % of control comparing methylated control vector (pCpG-hEF1 methylated) or methylated NHE3 promoter construct (pCpG-NHE3 methylated) with unmethylated control vector (pCpG-hEF1) or unmethylated NHE3 promoter construct (pCpG-NHE3). **P < 0.01 compared with unmethylated vector/construct as assessed by Student's t-test. C: effect of 5-azacytidine on DNA methylation in the promoter region of NHE3 in Caco-2 cells: DNA was extracted from Caco-2 cells treated with or without 5-azacytidine (10 μM) for 48 h. DNA methylation was determined by qPCR after MethyMiner precipitation using specific primers described in materials and methods, normalized to DNA input, and expressed as fold change. Results represent means ± SE of 3–4 separate experiments. **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test.

Article Snippet: Cloning and In Vitro Methylation of pCpG-Free NHE3 Vector For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ).

Techniques: DNA Methylation Assay, Activity Assay, Amplification, Clone Assay, Plasmid Preparation, Methylation, Construct, In Vitro, Transfection, Expressing

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

doi: 10.1152/ajpgi.00293.2017

Figure Lengend Snippet: 5-Azacytidine increases NHE3 expression in Caco-2 and HuTu 80 cells. A: Caco-2 cells grown on filter support were treated with 5-azacytidine (10 μM) for 24 or 48 h. Total RNA was then extracted from the untreated or treated cells. NHE3 mRNA expression was assessed by qRT-PCR. The relative abundance of NHE3 mRNA was normalized to GAPDH mRNA (internal control). The data were expressed as fold increase in arbitrary units compared with untreated control that is set as 1. Results represent means ± SE of 4 independent experiments. *P < 0.05 and **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test. B: total lysates were prepared from untreated or 5-azacytidine treated (10 μM, 24 h) cells. Extracted proteins (75 μg) were subjected to Western blot analysis on 7.5% SDS-PAGE using specific NHE3 antibody. The blots were stripped and reprobed with GAPDH antibody to indicate equal loading of protein in each lane. A representative blot of 3 different experiments is shown. The data were quantified by densitometric analysis, expressed as arbitrary units, and represent means ± SE of 3 separate experiments. *P < 0.05 compared with untreated control as assessed by Student's t-test. C: HuTu 80 cells were treated with 5-azacytidine (10 μM) for 48 h. Cells were then harvested, and RNA was isolated. NHE3 mRNA expression relative to GAPDH mRNA expression was assessed by qRT-PCR. The relative abundance of NHE3 mRNA was normalized to GAPDH mRNA (internal control). The data were expressed as fold increase in arbitrary units compared with untreated control that is set as 1. Results represent means ± SE of 3 independent experiments. **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test.

Article Snippet: Cloning and In Vitro Methylation of pCpG-Free NHE3 Vector For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ).

Techniques: Expressing, Quantitative RT-PCR, Western Blot, SDS Page, Isolation

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

doi: 10.1152/ajpgi.00293.2017

Figure Lengend Snippet: Small-interfering RNA (siRNA)-mediated knockdown of growth arrest and DNA damage-inducible 45b (GADD45b) decreases NHE3 expression in Caco-2 cells. Caco-2 cells were transfected with scrambled siRNA (control) or specific GADD45b siRNA. Cells were then harvested 72 h posttransfection, and total RNA was extracted. GADD45b mRNA (A) or NHE3 mRNA (B) expression in scrambled (control) or GADD45b siRNA-treated cells was assessed by qRT-PCR relative to GAPDH mRNA expression (internal control). NHE3 mRNA expression with respect to silencing of GADD45b was assessed by qRT-PCR relative to GAPDH expression. The data were expressed as fold change in arbitrary units compared with untreated control that is set as 1. Results represent means ± SE of 3 independent experiments. **P < 0.01 compared with scrambled siRNA-treated cells (control) as assessed by Student's t-test.

Article Snippet: Cloning and In Vitro Methylation of pCpG-Free NHE3 Vector For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ).

Techniques: Small Interfering RNA, Expressing, Transfection, Quantitative RT-PCR

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

doi: 10.1152/ajpgi.00293.2017

Figure Lengend Snippet: 5-Azacytidine increases NHE3 expression in mouse ileum and colon. 5-Azacytidine (10 mg/kg body wt) was administered to mice by ip injections (3 injections/wk for 3 wk), and the ileum and colon were harvested. Total RNA was extracted from the mucosal scrapings of ileum and colon, and NHE3 mRNA expression was assessed by qRT-PCR. A: the relative abundance of NHE3 mRNA was normalized to GAPDH mRNA (internal control). The data were expressed as fold increase in arbitrary units compared with untreated control. Results represent means ± SE of each animal group (n = 4–6 animals/group). *P < 0.05 and ***P < 0.001 compared with untreated mice (control) as assessed by Student's t-test. Total protein lysates were prepared from the mucosal scrapings of ileum (B) or colon (C) of untreated or 5-azacytidine-treated mice. Extracted proteins (75 μg) were subjected to Western blot analysis on 7.5% SDS-PAGE using specific NHE3 antibody. The blots were stripped and reprobed with GAPDH antibody to indicate equal loading of protein in each lane. A representative blot is shown. The data were quantified by densitometric analysis, expressed as arbitrary units, and represent means ± SE of each animal group (n = 4–6 animals/group). *P < 0.05 and **P < 0.01 compared with untreated control as assessed by Student's t-test. D: immunostaining of NHE3 protein in the colon of untreated (control) and 5-azacytidine-treated mice. Green, NHE3; red, villin; blue, nuclei; scale bar = 20 μm. Representative image is shown.

Article Snippet: Cloning and In Vitro Methylation of pCpG-Free NHE3 Vector For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ).

Techniques: Expressing, Quantitative RT-PCR, Western Blot, SDS Page, Immunostaining

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

doi: 10.1152/ajpgi.00293.2017

Figure Lengend Snippet: Loss of GADD45b decreases NHE3 expression in mouse ileum and colon. Age-matched (10–12 wk) wild-type (WT) and GADD45b KO mice were used for mRNA expression and immunofluorescence studies. Total RNA was extracted from the mucosal scrapings of ileum and colon, and NHE3 mRNA expression was assessed by qRT-PCR. A: the relative abundance of NHE3 mRNA was normalized to GAPDH mRNA (internal control). The data were expressed as fold decrease in arbitrary units compared with WT mice. Results represent means ± SE of each animal group (n = 4–6 animals/group). ***P < 0.001 compared with WT mice as assessed by Student's t-test. B: total protein lysates were prepared from the mucosal scrapings of ileum of WT or GADD45b KO mice. Extracted proteins (75 μg) were subjected to Western blot analysis on 7.5% SDS-PAGE using specific NHE3 antibody. The blots were stripped and reprobed with GAPDH antibody to indicate equal loading of protein in each lane. A representative blot is shown. The data were quantified by densitometric analysis, expressed as arbitrary units, and represent means ± SE of each animal group (n = 4–6 animals/group). *P < 0.05 compared with WT as assessed by Student's t-test. Immunostaining of NHE3 protein in the ileum (C) and colon (D) of WT and GADD45b KO mice. Green, NHE3; red, villin; blue, nuclei; scale bar = 20 μm. Representative images are shown.

Article Snippet: Cloning and In Vitro Methylation of pCpG-Free NHE3 Vector For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ).

Techniques: Expressing, Immunofluorescence, Quantitative RT-PCR, Western Blot, SDS Page, Immunostaining

Journal: Cell Stress & Chaperones

Article Title: Innate extracellular mouse Hsp70 inflammatory properties are mediated by the interaction of Siglec-E and LOX-1 receptors

doi: 10.1016/j.cstres.2025.100083

Figure Lengend Snippet: mHSP70 binds to murine Siglec-E. (a) CHO-K1 cells stably overexpressing Siglec-E-HA were treated with Alexa 488-tagged murine HSP70 (mHSP70) on ice for 30 min, and its binding was evaluated by flow cytometry. Untransfected CHO-K1 cells treated with Alexa 488-mHSP70 were used as controls. Anti-Siglec-E blocking antibody was added to neutralize the binding. * P < 0.05 or *** P < 0.001 when compared to mouse IgG using one-way analysis of variance with Tukey post-hoc test. (b) Representative confocal microscopy images of CHO cells stably overexpressing Siglec-E-HA and treated with Alexa 488-tagged mHSP70. Cells were then stained for HA (red). Magnification 400×. Scale bar = 5 µm. (c) Representation of the ELISA in which plates were coated with mHSP70 or BSA (negative control), followed by incubation with a Siglec-E-Fc chimera and a secondary horseradish peroxidase anti-mouse IgG. Representation created with BioRender.com. (d) Relative binding between mHSP70 to Siglec-E-Fc determined by ELISA. *** P < 0.001 when compared to BSA by t-test. (e) Representative confocal image of mHSP70 (green) binding to Siglec-E (red) in splenic DCs isolated from naïve wild-type mice with magnetic CD11c beads. Scale bar = 10 µm. Bars are represented as mean ± SD of triplicate. All data are representative of at least three independent experiments. Abbreviations used: mHsp70, mouse Hsp70; gMFI, geometric mean fluorescence intensity; BSA, bovine serum albumin.

Article Snippet: Primary antibodies used were: goat anti-mouse Siglec-E (polyclonal IgG, R&D Systems) and mouse anti-cell membrane Hsp70 (clone 1H11, StressMarq) were used as 1:100, rat anti-LOX-1 (polyclonal, from Dr Sawamura, described in was used at 1:200, mouse anti-HA antibody (clone 16B12, Covance) at 1:250, rabbit anti-caveolin (polyclonal, Sigma-Aldrich) and mouse anti-c-Myc (clone 9E10, Biolegend) were used as 1:300; rabbit anti-HA (cat H6908, Sigma) was used at 20 μg/mL.

Techniques: Stable Transfection, Binding Assay, Flow Cytometry, Blocking Assay, Confocal Microscopy, Staining, Enzyme-linked Immunosorbent Assay, Negative Control, Incubation, Isolation, Fluorescence

Journal: Cell Stress & Chaperones

Article Title: Innate extracellular mouse Hsp70 inflammatory properties are mediated by the interaction of Siglec-E and LOX-1 receptors

doi: 10.1016/j.cstres.2025.100083

Figure Lengend Snippet: Mouse Hsp70 is not glycosylated. (a) Analysis of N-glycans profile of extracellular mHsp70. (b) Fetuin was used as a positive control. MALDI-TOF mass spectrometry was performed in protein preparations in which the N-linked glycans were released enzymatically by PNGase F and permethylated, before being profiled. (c) SDS-PAGE of mHSP70 or fetuin treated or not with PNGase F (deglycosylation). (d) SNA lectin blot analysis of purified extracellular mHSP70 or fetuin (positive control) treated or not with PNGase F. (c) and (d) One representative gel from n = 3 biologically independent experiments. Abbreviation used: mHsp70, mouse Hsp70; MALDI-TOF, matrix-assisted laser desorption/ionization-time-to-flight; SNA, sambucus nigra lectin,

Article Snippet: Primary antibodies used were: goat anti-mouse Siglec-E (polyclonal IgG, R&D Systems) and mouse anti-cell membrane Hsp70 (clone 1H11, StressMarq) were used as 1:100, rat anti-LOX-1 (polyclonal, from Dr Sawamura, described in was used at 1:200, mouse anti-HA antibody (clone 16B12, Covance) at 1:250, rabbit anti-caveolin (polyclonal, Sigma-Aldrich) and mouse anti-c-Myc (clone 9E10, Biolegend) were used as 1:300; rabbit anti-HA (cat H6908, Sigma) was used at 20 μg/mL.

Techniques: Positive Control, Mass Spectrometry, SDS Page, Purification

Journal: Cell Stress & Chaperones

Article Title: Innate extracellular mouse Hsp70 inflammatory properties are mediated by the interaction of Siglec-E and LOX-1 receptors

doi: 10.1016/j.cstres.2025.100083

Figure Lengend Snippet: Siglec-E/LOX-1 complexes are localized in lipid microdomains. (a) CHO-LOX-1-Myc-Siglec-E-HA expressing cells were treated with Alexa 488-tagged extracellular murine HSP70 (mHSP70, 10 μg/mL) on ice for 30 min. Nonpermeabilized cells were then fixed and stained for c-Myc (red) and HA (Cyan) and analyzed by confocal microscopy. Representative confocal microscopy images of murine DCs isolated from naïve wild-type animals and treated with Alexa 488-tagged mHSP70 on ice (b) or at 37 °C (c) for 30 min. Nonpermeabilized cells were then fixed and stained for LOX-1 (red) and Siglec-E (Cyan). (d) Representative confocal microscopy images of murine nonpermeabilized DCs stained for endogenous mHSP70 (green), LOX-1 (red), and Siglec-E (Cyan) at 4 °C. (e) Representative confocal microscopy images of nonpermeabilized murine DCs stained for caveolin (orange), LOX-1 (red), and Siglec-E (Cyan) at 4 °C (a–e). Magnification 400×. Scale bars = 5 µm. (f) Wild-type splenocytes were treated for 2 h with methyl β cyclodextrin (20 mM, cholesterol-sequestering agent) before stimulation with mHSP70 for 30 min. Spleen cell lysates were precipitated with either Siglec-E-specific antibody or control goat IgG. Precipitates were probed with antibodies specific to LOX-1 or Siglec-E (input). One representative gel and densitometric analysis of the three biologically independent experiments. Complete membrane blots are included in . Abbreviations used: DCs, dendritic cells; LOX-1, lectin-like oxidized low-density lipoprotein receptor-1; mHsp70, mouse Hsp70.

Article Snippet: Primary antibodies used were: goat anti-mouse Siglec-E (polyclonal IgG, R&D Systems) and mouse anti-cell membrane Hsp70 (clone 1H11, StressMarq) were used as 1:100, rat anti-LOX-1 (polyclonal, from Dr Sawamura, described in was used at 1:200, mouse anti-HA antibody (clone 16B12, Covance) at 1:250, rabbit anti-caveolin (polyclonal, Sigma-Aldrich) and mouse anti-c-Myc (clone 9E10, Biolegend) were used as 1:300; rabbit anti-HA (cat H6908, Sigma) was used at 20 μg/mL.

Techniques: Expressing, Staining, Confocal Microscopy, Isolation, Control, Membrane

Journal: Cell Stress & Chaperones

Article Title: Innate extracellular mouse Hsp70 inflammatory properties are mediated by the interaction of Siglec-E and LOX-1 receptors

doi: 10.1016/j.cstres.2025.100083

Figure Lengend Snippet: The absence of Siglec-E increases LOX-1-mediated maturation of DCs. (a) Wild-type (WT) or Siglec-E KO (SigEKO) bone-marrow-derived dendritic cells were treated with increasing doses of oxLDL or mHSP70 for 24 h, and MHC II hi CD86 hi cells were evaluated by flow cytometry. ** P < 0.01, *** P < 0.001 compared to WT by one-way analysis of variance (ANOVA) with Tukey post test. The experiments represent two repetitions performed in triplicate of a pool of two mice per genotype. * P < 0.05, ** P < 0.01, *** P < 0.001 compared to WT by one-way ANOVA with Tukey post test. WT cells are represented in gray, and Siglec-E KO in orange. WT or Siglec-E KO bone-marrow-derived dendritic cells were treated with 50 μg/mL of oxLDL or 50 μg/mL of mHSP70 for 30 min, and the expression of (b) phospho-Src (p-Src) or (c) SHP-1 was assessed using flow cytometry. ** P < 0.01, *** P < 0.001 when compared to WT by one-way ANOVA with Tukey post test. Abbreviations used: Iso Ctrl, isotype control; LOX-1, lectin-like oxidized low-density lipoprotein receptor-1; mHsp70, mouse Hsp70; oxLDL, oxidized LDL.

Article Snippet: Primary antibodies used were: goat anti-mouse Siglec-E (polyclonal IgG, R&D Systems) and mouse anti-cell membrane Hsp70 (clone 1H11, StressMarq) were used as 1:100, rat anti-LOX-1 (polyclonal, from Dr Sawamura, described in was used at 1:200, mouse anti-HA antibody (clone 16B12, Covance) at 1:250, rabbit anti-caveolin (polyclonal, Sigma-Aldrich) and mouse anti-c-Myc (clone 9E10, Biolegend) were used as 1:300; rabbit anti-HA (cat H6908, Sigma) was used at 20 μg/mL.

Techniques: Derivative Assay, Flow Cytometry, Expressing, Control